عنوان پرایمر Working مورد استفاده قرار گرفتند.
Accession Number
Product Length
(bp)
Primer sequence (5′?3′)
Gene
NM_007987/2
۱۷۵
TTTGCTGTCAACCATGCCA

TCCACCTCTAAACCATGCTC

FAS-F

FAS-R

NM_010177/4
۱۷۹
ATCACAACCACTCCCACTG

GGTTGGTGAACTCACGGAG

FAS ligand-F

FAS

مطلب مرتبط :   دانلود پایان نامه درباره-۰.۰۰۰۱، ۰.۰۰۰۱، ۰.۰۰۱۱،
دسته بندی : No category

دیدگاهتان را بنویسید